Skip to content

Latest commit

 

History

1,959 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

BLANT: Basic Local Alignment of Network Topology

If you want to install BLANT, just follow the directions immediately below. If you first want to know what BLANT is, look a little lower.

Quick Start guide

Prediction

If you happen to be here only to test the released version of BLANT-predict, then do this on the Unix/Bash command-line: (PS: ensure you have make, gcc, and other standard Unix tools available.)

git clone --recursive http://github.com/waynebhayes/BLANT &&
    cd BLANT &&
    PAUSE=0 NO7=1 make base && ./blant-predict-example.sh 100

That should take a few minutes, and then print the number of correct predictions applied to Vidal's HI-union network out of 100 (it should be about 35-40% correct). After that, you can just run ./blant-predict-example.sh [N] with some other value of N.

Building BLANT for the first time

To make and then test everything just type

./regression-test-all.sh -make

Be warned it may take up to an hour, especially creating the k=8 lookup tables--to make it run faster, add "NO8=1" in front of the above line. Note that doing the above performs a "make pristine", which is even cleaner than "make clean". In particular, "clean" cleans all executables but doesn't touch the lookup tables; use "make pristine" to remove even the lookup tables (which shouldn't be necessary since they never change, though they take up disk space).

Once the above is done, you should have an executable called "blant" in the main repo directory, as well as many files in the directory canon_maps; these are the lookup tables and associated files that allow BLANT to sample graphlets so fast. Except for major BLANT upgrades, you normally shouldn't ever need to touch anything in the canon_maps directory; make it once and forget about it. Note that even "make clean" doesn't nuke the contents of canon_maps; to do that, type "make pristine".

BLANT has been tested and runs on a wide variety of systems, including various flavors of Linux running with GCC/G++ versions 4 through 11 inclusive; Windows CYGWIN both 32-bit and 64-bit (yes, BLANT runs fine on 32-bit machines); and MacOS (both Intel and M1/M2) using clang and/or GCC/G++ available via homebrew. The only parts that may fail are the parts written in Python, which is a nightmare to work with on "real world" projects since it's prone to horrible software rot on a timescale of weeks to months.

Things that may go wrong: Stack Size, unxz, 7z, and DOS/Windows CRLF

You may need to install xz (a compression program) and 7z (another compression program). Before starting anything below, you need to ensure your OS allows your programs enough stack space. Some machines today still ship with a default limit of 8MB---a ridiculously small limit on any machine built after about 1999. You do not require sudo privileges to change this. If you're running Linux or MacOS, type "ulimit -s unlimited" to your Bash shell; if you're running any other system, you're on your own.

Also, if you edit any of the text files in the BLANT repo using a Windows-based text editor (eg., VSCode), then your editor might add a "carriage return" (CR) to the end of every line in a text file... which confuses the Unix programs like BASH, that expect only a "line feed" (LF). If that happens, you may need to checkout all the files again using "git checkout '*'", or use the "dos2unix" program to remove the CRs. Specifically, if you see an error message something like this the below, then that's almost certainly your problem:

/bin/bash^M: bad interpreter

Also, some useful utilities are in the directory libwayne/bin; you may want to add that directory to your PATH because some scripts in BLANT depend on them. Some of the programs there are

  • hawk: Hayes AWK, a script that adds a huge number of useful functions to AWK via the file misc.awk
  • awkcel: allow AWK to process tab-separated files with a header line where each header is a valid AWK variable name and then you can use those names in awk expressions. (The name "awkcel" rhymes with a particularly populer spreadsheet name you're probably familiar with).
  • wzcat: Wayne's "zcat", which is basically "cat" augmented to automatically decompress any files with recognized file extensions (eg filenames with the extension ".gz" will be automaticaly passed though "gunzip", ".xz" through "unxz", etc.)
  • wgcc: Wayne's gcc, which is just a front-end to gcc that automatically includes "libwayne" include and library directories.

What is BLANT? An analogy with BLAST

If you are in the bioinformatics field, you have probably heard of the tool named BLAST, the Basic Local Alignment Search Tool. BLAST is an algorithm for quickly finding local alignments in genomic (or proteomic) sequences. BLAST works by first creating a comprehensive database of all k-letter sequences (called "k-mers") that appear in the corpus of the sequence to be searched and/or aligned. Such k-mers can be used to "seed" a local alignment between two distant regions of sequence. Below we show a hypothetical alignment between two distant regions of sequence, both of which contain the boldfaced k-mer "GAGACCGT":

ACTAGATCCACCTCTAGGCAGGTA GAGACCGT GTTCTTCAGAGGTGAAGGAGACGCACAAACGGGCCC

ACTAGATACACGTCTAGGCAGGTA GAGACCGT GTTCTTCATAGGTGACGGAGACGCACAAACGGGCCC

By storing every k-mer and its location, BLAST can "line up" the regions around two identical k-mers, and then check to see if this local alignment "extends" further beyond the k-mers. In the case above, even though the sequences contain minor differences (highlighted with italics), the fact that they contain the depicted k-mer seed means we can still find the near-perfect match. BLAST is extremely fast at performing the above operations, which is the reason BLAST has become the near-ubiquitous tool for comparing and aligning sequences that contain billions of letters. BLAST automatically chooses the appropriate value of k to create k-mer seeds in a particular search and alignment task, and uses a sophisticated extend algorithm to create full seed-and-extend local alignments.

Our new tool, called BLANT (Basic Local Aligment of Network Topology), is intended to form the basis of a seed-and-extend local alignment algorithm, but for networks: given an undirected network G, and a value of k, it samples connected k-node subgraphs called k-graphlets. Since the number of k-graphlets in a graph of n nodes is exponential in both k and n, BLANT does not exhaustively enumerate all k-graphlets, but instead samples them--either randomly as many as the user specifies, or deterministically using our own algorithm to create a index that can be used for actual local alignments. In the random case, uniform random sampling of k-graphlets is difficult, so there are several choices among sampling methods, each with different trade-offs. Finally, BLANT allows for several different methods of output: it can produce orbit-degree vectors (ODVs) like ORCA, or graphlet frequencies, or an explicit list of k-graphlets that can be used as seeds for later extension. At present, BLANT does not provide an "extend" functionality; there are many seed-and-extend local alignment algorithms in the literature, each with its own method of seeding and extending. Although BLANT currently is by far the fastest method of producing a large number of seeds, we have not yet tested how the various extend algorithms perform using our seeds; this is a clear area of future work, and suggestions are welcome. Despite the lack of an "extend" feature, BLANT is still capable of useful bioinformatics, as described in our tool paper in the journal Bioinformatics.

USAGE

Required Command-line arguments

SYNOPSIS (things inside {} are mandatory; those inside [] are optional; if no source network is given, it is read from the standard input). Note that you can just run "./blant" without any arguments to get help.

./blant {-k graphletSize} sourceNetwork.el

-k k: graphlet size (from k=3 up to k=8) of graphlets to sample. This is the only required argument (other than the input network)

k is an integer that can be 3 through 8 inclusive, and represents the number of nodes in the graphlets that will be sampled. For now BLANT almost always samples only connected graphlets, returning a disconnected "graphette" only if there is a connected component in the input graph that has fewer than k nodes; such disconnected graphlets are never returned by the MCMC method.

sourceNetwork.el: the input network.

For now the most acceptable format is an "edge list" file: two nodes representing an edge on each input line.

Common optional command-line arguments

./blant {-k graphletSize} [-m outputMode] [-s samplingMethod] [-d displayMode] [-p precision | -n numSamples] sourceNetwork.el

-p {precision}: if <1, it represents the desired fractional precision of counts; if >=1, it repreents the desired number of digits of precision.

For example, "-p 0.01" and "-p 2" both mean "2 digits of precision", equivalent to a fractional precision of 0.01 (1%).

-n {integer}: [DEPRECATED: use -p instead] the number of random graphlet samples to take

n is a non-negative integer representing the total number of graphlets that should be sampled. 0 is allowed; values into the billions are feasible (more if you use parallelism).

-m{outputMode}: how to use the sampled graphlets on output. All output goes to the standard output (aka "terminal")

outputMode is a single character, one of the following:

-mfD: frequency mode (with display D option)

BLANT's output will consist of two columns: the first column is a frequency, the 2nd column is the ID of the canonical graphlet. Lines are output in order of the canonical graphlets, and the number of lines of output is exactly equal to the number of canonical graphlets that exist for the given value of k; even graphlets with a zero count are output. Furthermore, another character D can be appended to -mf, which can be either an i (integer) representing that the frequency should be displayed as a raw integer count, or d (density) in which case the frequencies are normalized to a "density" (aka "concentration"); the latter is useful in comparing frequencies that used different numbers of samples (cf. -n option). If D is omitted, it defaults to i for all sampling methods except MCMC, which defaults to d.

-mo: ORCA/ODV (Orbit Degree Vector) format

The output here is similar to ORCA's output: the number of lines is exactly equal to the number of nodes in the input graph, and the number of columns is equal to the number of orbits that exist for the given value of k. The integer in each location is the number of times that node "touched" the specified orbit. Unlike ORCA, where this value is a deterministic constant since ORCA performs exhaustive enumeration, the value output by BLANT will be stochastic and depend on the sampling method, the number of samples, and any bias inherent in the random sampling method. However, these values should be roughly proportional to ORCA's output (modulo sample size), and the similarity should improve with increasing sample size.

-mg: GDV (Graphlet Degree Vector) format

Similar to ODV format above, except for each node, the columns are the number of times that node touches a particular graphlet, independent of which orbit is touched. NOTE: beware that many authors use the term GDV when they are in fact referring to an ODV. BLANT is more precise in clearly distinguishing between the two.

-mi: graphlet indexing mode

This is the mode that is most unique to BLANT: it outputs as many lines as there are samples (see -n above)---beware that if n is large, this can produce huge output files. Each line consists of exactly (k+1) columns: first, the canonical ID of the graphlet that was sampled, and then exactly k node identifiers (using whatever node naming scheme that was in the network input file). Most importantly, BLANT guarantees that for any two lines that have the same ID in the first column (ie., they are the same graphlet), the remaining columns are in an order that imposes an exact local alignment between the two. (There may be more than one local alignment depending on the orbits in said graphlet, but BLANT only outputs one such local alignment.) This is the mode that can be used to create a database of k-graphlets that can act as seeds for future implementations of an "extend" algorithm to produce local alignments with more than k nodes. (Note, however, that while BLAST can produce an exhaustive list of all k-mers in a sequence corpus since their number is linear in the amount of sequence, BLANT only produces a random sample of k-graphlets; this means an extend algorithm cannot assume that the list of identical k-graphlets produced by BLANT is exhaustive. However, with enough samples, every node in a graph corpus can be "covered" by multiple k-graphlet seeds, and we believe this multiple coverage can be leveraged to produce larger local alignments.)

-mj: orbit indexing mode

Similar to -mi above, except nodes that occupy the same orbit are output separated by colons. Thus, the number of space-separated columns (excluding the first column, which is still the canonical ID of the sampled graphlet) is the number of orbits in the graphlet. Unlike -mi mode, the order of the nodes is not guaranteed to impose a local alignment, but instead all that is guaranteed is that if the same set of nodes is sampled more than once, they will be output in a constant order; this allows duplicates to be detected.

-s {samplingMethod}: the method used to sample graphlets

BLANT can sample graphlets in many different ways, each with advantages and disadvantages. The allowed values are:

NBE (Node Based Expansion)

BLANT picks an edge from the input network uniformly at random. The two endpoint nodes initialize the set S of nodes. The remaining (k-2) nodes are added to S by finding all nodes that are adjacent to the current set of nodes (excluding those already in S), and then picking one such node uniformly at random. We return the sampled graphlet when |S|=k. If at any point the set of nodes adjacent to S (excluding nodes inside S) is null, then S is retained by selecting a new starting location chosen uniformly at random. This can only happen if the initial edge is picked from a connected component C that has fewer than k nodes; in that case, S will be a disconnected graphlet (aka graphette) that consists of C, plus (k-|C|) nodes from elsewhere in the input network. The NBE method is not guaranteed to produce graphlet samples that are unbiased, although empirically we have found it is not terribly biased. Each sample produced by NBE starts at a new random edge, and so NBE tends to "see" most regions of the network even if the number of samples is small.

EBE (Edge Based Expansion)

Node based expansion (NBE) can be slow if the mean degree of the network is large. For networks with high mean degree, the EBE sampling method is asymptotically faster than NBE, though it may be more biased. Like NBE, it starts each sample with a freshly chosen edge from the network, so that widely separated regions are sampled with ease. Then, one edge is chosen uniformly at random from all edges emanating from S. Note that, while NBE choses among nodes adjacent to S with equal probability, EBE follows edges emanating from S with equal probability. This means that (a) the next node added to S is more likely to be a neighbor of a node in S with many edges emanating from S than one with few edges emanating from S---in other words, the choice of next node added to S is dominated by "hubs" already in S; and (b) a node adjacent to S is chosen with probability proportional to the number of edges that reach it from inside S.

RES (Reservior sampling)

Starting with an NBE-created sample of S nodes, we take a small number of "steps" where one node is deleted from S and simultaneously a randomly chosen node adjacent to S is added. This random walk erases the memory of where NBE started and tends to reduce the bias of NBE.

MCMC (Markov Chain Monte Carlo)

This method is the fastest per sample, and in the long run is also guaranteed to produce unbiased samples (ie., those whose relative frequencies approach those of ORCA's exhaustive enumeration). It starts with a randomly chosen edge, then builds S similar to NBE, and outputs one sample. However, unlike the other methods, it takes a long random walk by deleting one node from S and randomly adding one node adjacent to S, and then outputting that new set as a new sample. This has the effect that, on short timescales, each sample differs from the previous sample by only one (or a few) nodes. Thus, for example, in indexing mode (-mi), adjacent lines in the output will have many nodes in common. This has the disadvantage that it may take a long time for the MCMC method to "visit" all regions of the network. On the other hand, MCMC is very fast per sample, because only one (or a few) nodes change between samples. Furthermore, the MCMC method computes the bias on-the-fly, and in the long run the -mf mode will output concentrations that are asymptotically correct---although indexing mode should not be used to estimate graphlet frequencies because indexing mode does not take these computed biases into account.

AR (accept/reject)

AR is a horrendously slow but asymptotically correct method of picking k nodes uniformly at random, and accepting the sample only if the k nodes form a connected graphlet. For large values of k and for most typical input networks that are sparse, this results in the vast majority of k-node sets being rejected. This method is not recommended since it is exponentially slow with large values of k.

Optional command-line arguments

-tN: run BLANT in parallel mode with N threads.

For all modes except indexing (-mi) mode, speedup should be linear (this has been tested on a machine with 64 cores, and speedup is linear.) However, with indexing mode, the processes are I/O bound and speedup is only linear up to about 8 threads, and little speedup is observed beyond 8 threads.

-dm: displayMode

Display mode determines how the graphlet ID of the sampled graphlet is displayed: default is i, BLANT's internal integer ordinal of the canonical (order similar to that described in Hasan, Chung, Hayes 2017 except using the lower rather than upper triangle, to be more compatible with Jesse. Other formats include d, the decimal value of the canonical; b the same integer dispalyed as binary; j use Jesse's ID; and o use ORCA's ID.

-mw: Windowing mode

Experimental, may be discontinued.

-wl: Window sampling method

Currently unused and experimental; may be removed.

Brief description of internals and source code structure

Directories

Directory libwayne

An extensive C-language library by Wayne Hayes, similar to a "class" library in C++ , containing old and well-tested code implementing data structures and algorithms for graphs, sets, multisets, combinatorics, heaps, stacks, compressed flies, searching + sorting, linked lists, event-driven simulation and numerical analysis (the latter few not used much in BLANT but included for completeness). See Wayne's Little Data Structures and Algorithms library. This library is necessary for BLANT and is created when "make" or "make all" is performed; libwayne was written mostly before C++ was invented, and most of its functionality is significantly faster and more memory efficient than equivalent C++ classes.

Directory networks

A directory containing many example input networks in edge list (2-columns, space or tab separated) format. While BLANT also accepts other input formats such as GML and LEDA, edge lists are the simplest and most recommended.

Directory orca_jesse_blant_table

Many methods of automatically (and manually) identifying all the various graphlets exist. There is the original manually-generated numbering of graphlets of size 3, 4, and 5 nodes (Przulj et al 2004) which is also used by the popular program ORCA, and the automatic methods from Jesse, and our own (Hasan, Chung, Hayes) which has been modified from using an upper- to lower-triangle representation for BLANT, following Jesse's lead. This directory contains code to translate between all these different naming conventions, including both the graphlet and orbit numbering schemes.

Directory regression_tests

As the name applies, this directory contains regression tests, in the following format: each subdirectory contains code and data for one regression test. Any filename in such a directory whose name ends in ".sh" will be automatically run by the program regression-test-all.sh, which is run nightly by the senior author on a Jenkins machine. If you add functionality to BLANT, you are encouraged to create a directory here with your own regression test, and then do a pull request to me to add your code to the main BLANT repo (it's best to send me an email first at whayes@uci.edu to discuss it first).

Directory canon_maps.correct

Contains correct output for comparison to files in canon_maps to ensure your installation of BLANT is working correctly.

Directory "canon_maps"

Though not in the repo, this crucial directory is built when you install BLANT using "make" or "make all". It contains the lookup tables from all possible graphlets to the "canonical" ones; these lookup tables are the secret to BLANT's speed. See Hasan, Chung, Hayes (2017).

Directory "Draw"

Contains code to create PDFs that depict any graphlet BLANT uses. Type "make Draw" to create the program Draw/graphette2dot. Then run ./Draw/graphette2dot for help and options. All graphette2dot does is create an input file and a command line for use by the "neato" command, which performs the actual creation of a PDF. So for example, to draw the 3-graphlet which is a triangle, run

./Draw/graphette2dot -k 3 -i 3 -o triangle | sh

That will create a file called "triangle.dot" and the command line for neato to convert triangle.dot to triangle.pdf; piping the output to sh simply runs the neato command, which actually generates the triangle.pdf file.

Brief manifest and description of source files

Makefile

Highlights: k=8 files may take quite a while to create (up to an hour); if you are only interested in sampling graphlets up to k=7, comment out the "EIGHT" variable near the top of the Makefile, and the "make" will finish in a few minutes rather than an hour. ("make all" also performs some extensive testing and will take longer even without EIGHT.)

The first time you install BLANT, it's best to run "make all". This may take up to an hour (or a few minutes if you exclude k=8). This will create all the files necessary to run BLANT, as well as run some tests. Thereafter, any changes you make should require only to type "make". You can run sanity and regression tests using "make test_blant".

blant-sanity.c

Run during "make test_blant" from the Makefile, it takes the output of BLANT's index mode and verifies that each graphlet with the same ID is actually identical.

blant.c and blant.h

Main source code and header files that takes user input that specifies the value of k, the desired sampling method and number of samples, output mode, and input network. It then creates the internal graph, starts parallel invokations of BLANT if requested by the user (for increased speed), then performs graphlet sampling of the requested number of k-graphlets using the requested sampling method. Along the way it reads or mmap()'s several large files from the canon_maps directory.

compare_canon_maps.cpp

Small code changes can sometimes result in different (but still correct) permutations between non-canonical and canonical graphlets (See Hasan, Chung, Hayes (2017).) This program checks two different canonical permutation mappings to ensure that they are equivalent. That is, one file is correct if and only if the other is correct.

compute-alphas-{MCMC|NBE}

As a part of the unbiased MCMC graphlet sampling method, and as a preliminary implementatino of an unbiased NBE method, the alpha values determine the expected over/under representation of each type of graphlet sampled. These programs compute those alpha values.

convert.cpp

Code that allows BLANT to take input of various graph representations such as edge list, GML, and LEDA formats.

create-bin-data.c

This program reads the text-format output of fast-canon-map.c (see below), creating the internal lookup and permutation tables. Then, it simply dumps those tables into binary files that can be quickly read or mmap()'d; mmap()'ing these binary files is hundreds of times faster than reading the text files, which makes BLANT's startup time virtually instantaneous even for the 1.25GB canon_map and permutation files required for k=8.

fast-canon-map.c

This file creates the text version of the non-canonical to canonical lookup table and permutation map for any value of k from 3 to 8. It's only run once in the Makefile to create files in the canon_maps directory; these text output files will be converted to binary files by create-bin-data.c (see above). fast-canon-map runs virtually instantaneously for all values of k up to 6; k=7 takes less than a minute, while k=8 can take anywhere from 5 minutes to an hour depending on the speed of your computer. These files normally only need to be created once. If you are not interested in k=8, you can comment out the variable EIGHT in the Makefile.

libblant.c

A collection of often-used routines needed by most of the other C files including blant.c, fast-canon-map.c, create-bin-data.c, etc. Prototypes for the functions contained herein are all in blant.h

magictable.cpp

Code to convert between all the various naming/numbering schemes of graphlets (see Directory orca_jesse_blant_table above).

make-orbit-maps.c

After creating the list of all non-canonical and canonical graphlets for a given value of k, this program enumerates all the orbits of each canonical, putting the data in to the file canon_maps/orbit_mapk.txt

make-subcanon_maps.c

Each canonical graphlet of size k contains exactly k subgraphs of size (k-1) (not all of which may be connected). This program computes these subgraphs and their canonical IDs. Although not yet used, these sub-canon maps will be used later for more efficient search and alignment.

makeEHD.c

EHD stands for Edge Hamming Distance: it is the minimum number of edges required to convert one canonical graphlet to another, and although not yet used by BLANT, they will be used later to implement partial / approximate graphlet matching (ie., matching graphlets with missing or exta edges). This file creates the lookup table representing the EHD between any two canonical graphlets.

regression-test-all.sh

Script to iterate through each directory in Directory regression-tests, running any script inside whose name ends in ".sh"; such scripts should perform one or more regression tests using other files in the given directory; a regression test that fails should return a non-zero exit status, which will cause the parent regression to fail as well.

slow-canon-maps.c

The old (deprected) algorithm described in Hasan, Chung, Hayes. Replaced by fast-canon-maps.c above, which is exponentially faster.

test-bin-data.c

Testing code for files created by create-bin-data.c above.

Understanding canonical vs. non-canonical graphlets

Here's the basics you need to know. Let's take k=3 as an example, even though we don't care about k=3 in our edge prediction code. (Actually we could but that's another story.) We use 8 unsigned chars of 8 bits each to represent the (k x k) bit adjacency matrix (which is the primary reason we're restricted to a maximum of k=8). We always ensure this matrix is symmetric, and the data type in BLANT is called TINY_GRAPH. Now given any particular k-node graph(let), we read the bits in the lower triangle (below the diagonal) and turn that into an integer of exactly (k choose 2) bits, eg 3 bits for k=8, 28 bits for k=8. The result, for all possible k x k matrices, is in the file canon_maps/canon_mapK.txt. For example canon_map3.txt looks like this:

  0       012 0 0
  1       012 0 1
  1       102
  3       012 1 2
  1       201
  3       021
  3       120
  7       012 1 3

(Note: the most recent version of BLANT also lists the actual edges after the number of edges, but I've removed them for simplicity.) Now, there is an implicit, missing column, which I'll call the "zeroth" column, and it's just the line number, starting from zero. If I add that implicit column (using the command "nl -v 0 canon_maps/canon_map3.txt), we get

 0  0       012 0 0
 1  1       012 0 1
 2  1       102
 3  3       012 1 2
 4  1       201
 5  3       021
 6  3       120
 7  7       012 1 3

That zeroth column is the integer we get from reading the bits of the lower triangle of the adjacency matrix, and in the BLANT code it's usually called "Gint". Since the same graph can be drawn in many different ways (all isomorphic), we need to choose one of them as the "canonical representative" of all the identical drawings of that particular graphlet. For that we simply choose the one with the lowest integer representation; and for all the non-canonical versions of the same graph, we store the permutation of nodes that gets us from the canonical to the non-canonical one. In the canon_mapK.txt file, there are 2 columns if the graphlet is non-canonical and they simply store the integer (decimal) value of the canonical representative, and the permutation. If the graphlet is the canonical one, then the permutation is the identity (012 in the k=3 case), and the 2nd last column is a Boolean telling us if the graphlet is connected, and the last column is the number of edges in the graphlet.

The reason you have such a huge memory footprint is because, for example, for k=8, there are 256 million (2^28) graphlets before converting to canonicals. So for example the tail end of the canon_map8.txt file looks like this:

  67108863        73601245
  134217727       37012456
  50331647        74560123
  67108863        74501236
  67108863        74601235
  134217727       47012356
  67108863        75601234
  134217727       57012346
  134217727       67012345
  268435455       01234567        1 28

So for example the very last line is the k-clique, meaning all possible edges exist, and so its integer value is (2^28 - 1); the two graphlets before it happen to be the same garphlet (clique missing one edge) but drawn in different ways. You can tell because the first column is the same (134217727) meaning they have the same canonical representative.

You probably don't need to understand all the above but it's helpful in understanding what follows, which you do need to understand to work with canonicals.

Now the problem with using the integer value of the canonical as an actual identifier is that the integer is too big: in the above case we need all 28 bits to store the integer value of the canonical. However, even for k=8, there are only 12,346 actual canonical graphlets, and 12,346 can be stored as a 16-bit (short) integer, which is a much smaller memory footprint. So, the last step in figuring the ID that we actually use is to extract only the lines of the canon_mapK.txt file that are canonical representatives; this is what the file "canon_listK.txt" contains. For example canon_list3.txt is:

  4
  0       0 0
  1       0 1     
  3       1 2     
  7       1 3     

The first line simply tells us the number of canonical graphlets (4); the following lines are identical to the lines extracted from the canon_mapK.txt file (and again I've removed the list of edges that are in the actual file for simplicity).

Finally, we use the line number (starting from zero, and not including the top line that is '4' above) as the actual identifier. In the code this is usually called GintOrdinal (ordinal simply meaning "the number you get by ordering the canonicals smallest to largest"). If we run "nl -v -1 canon_maps/canon_list3.txt" we get:

-1  4
 0  0       0 0
 1  1       0 1     
 2  3       1 2     
 3  7       1 3     

so there are 4 canonicals for k=3, called 0, 1, 2, and 3 (ie., the value of GintOrdinal). (If you actually want the integer value you can use the _canonList[] array inside blant, eg _canonList[GintOrdinal] gives the integer value of the canonical whose ID is GintOrdinal).

So, hopefully, with all that, you'll now understand the following lines I've taken from blant-output.c, which is at the top of the function ProcessGraphlet:

Boolean ProcessGraphlet(GRAPH *G, SET *V, unsigned Varray[], const int k, TINY_GRAPH *g) { TinyGraphInducedFromGraph(g, G, Varray); // create the TINY_GRAPH g, induced from the big one G Gint_type Gint = TinyGraph2Int(g,k); // extract integer from lower triangle of TINY_GRAPH g, into Gint. Gint_type GintOrdinal=L_K(Gint); // Use the lookup table L_K to find the GintOrdinal of Gint.

Voila. That's it really. You only need lookup tables for the canonicals. Immediately above and below these lines in blant-output.c are examples of how to move around between the canonical graphlet, the non-canonical graphlet we came from, and the list of nodes in the bigger graph (stored in Varray[]). So for example above, in the function PrintIndexOrbitsEntry, you see the line

PrintNode(':', Varray[(int)perm[ j1 ]]));

To decode what's happening: the integer j1 is iterating through the nodes in the canonical graphlet from 0 through k-1 inclusive; perm[ j1 ] tells us which node (0 through k-1) is the corresponding graphlet node of the non-canonical graphlet we came from; and Varray[(int)perm[j1]]) is the ID of the corresponding node in the bigger graph (an integer from 0 to about 9,000 for HI-union.)

Hopefully that'll help you figure out how to use only canonicals to store your matrices. Lemme know if you have any questions.

References

Our first paper on how BLANT performs so quickly on up to k=8 node graphlets: Hasan, Adib, Po-Chien Chung, and Wayne Hayes. "Graphettes: Constant-time determination of graphlet and orbit identity including (possibly disconnected) graphlets up to size 8." PloS one 12, no. 8 (2017): e0181570.

First conference presentation about BLANT: Hayes, W. and Maharaj, S., 2018. BLANT: sampling graphlets in a flash. q-bio, Rice University, Houston, Texas, USA.

Journal "tool" announcement in BioInformatics: Maharaj, Sridevi, Brennan Tracy, and Wayne B. Hayes. "BLANT—fast graphlet sampling tool." Bioinformatics 35, no. 24 (2019): 5363-5364.

About

Basic Local Alignment of Network Topology - fast, unbiased statistical graphlet sampling for any graphlet use

Resources

Stars

28 stars

Watchers

3 watching

Forks

Releases

Packages

Used by

Contributors

Languages